Political Considerations and Managing Political Risk in an Ever Research Paper

Political Considerations and Managing Political Risk in an Ever Evolving Global Marketplace - Research Paper Example This paper declares that the increased rate of globalization throughout the world has created a dynamic in which decision-makers within international business must consider able to factors as a means of continuing to expand the markets in which they operate and generate an even higher level of profitability. Ultimately, even a cursory level of business analysis reveals the fact that a company which does not focus itself on development and expansion will ultimately collapse and become nonviable. As a direct interpretation of this, it is necessary for firms to be international in their scope and to continually attempt to broaden the overall level of consumers that they are able to engage with. As the paper stresses recognizing how to manage political risk while conducting international business is an essential element that managers should be able to comprehend and understand. Without this understanding managers will be at a disadvantage and will place themselves at risk and even in harm’s way if they are not careful. Political landscapes shape businesses that operate overseas. These landscapes must be navigated carefully and with ethics in mind. Strong core values will be essential to their success. An effective understanding of â€Å"political risk† can be effected through an appreciation of societal organization; specifically the means by which the rules of law, or lack thereof, define the way in which a given region might be represented.

A Closer Look at Watchmens Dr Manhattan Essay Example for Free

A Closer Look at Watchmens Dr Manhattan Essay Neil Armstrong, Clark Kent, John F. Kennedy, Professor Charles Xavier, Gandhi, Chuck Norris, Master Yoda. The men mentioned above are fictional or real characters with quite a few things in common. They are all heroes in their respective universes, they fight for what is good, and they are all experts in their fields of profession. In fact, they are the supposed best or the most renowned at what they do. Neil Armstrong has to be the most famous Astronaut of all time while Clark Kent’s alter ego, Superman is arguably the greatest superhero there is and if not, he is definitely the most famous. Chuck Norris is the best ass-kicker in the world while Professor X is the greatest telepath in the Marvel Universe. JFK was a great president, Gandhi changed revolution, and Master Yoda taught nine hundred years’ worth of Jedi Knights. Yes, these men are all very talented and very powerful. However, these outstanding heroes have one more thing in Common: they all fall nothing short of insignificant to the power, intelligence, and capabilities of Dr. Manhattan. Dr Manhattan’s powers and abilities include immortality, shapeshifting to any form he chooses, seeing the future, reading minds, teleportation, and bending matter to his will. He practically has no physical weaknesses. Superman and Yoda could possibly put up a fight but that’s another story. In the world of Watchmen, Dr. Manhattan made human life appear insignificant. Yes, insignificant. Can you imagine? The supposed dominant species in the world could have been a clump of dirt on Dr. Manhattan’s shoe compared to his Godlike persona. This became the aggravating external conflict Dr. Manhattan had with humans. In fact, Dr. Manhattan ended up believing that Humans had become irrelevant and mattered little to him, thus, resulted in him eventually leaving Earth and living on Mars. This caused momentous discomfort and major uproar in Earth, namely, The United States. Dr. Manhattan may have lost his purpose of necessity for human beings but The United States needed him as if their lives depended on it. In fact, The United States practically worshipped him as a God. In the Watchmen storyline, The Cold War between the Russians and the Americans was at the brink of becoming nuclear warfare and either side was very close to opening fire and sending all their nuclear warheads at each other. If both sides fired every missile they had, they would destroy all human life on Earth. Dr. Manhattan, being America’s greatest weapon and greatest defence, was expected to use his power and eliminate every Russian warhead that he could and give the United States a chance to fire back at Russia and ultimately win the Cold War. What the Americans hadn’t counted on was Dr. Manhattan leaving Earth after losing his temper during a live-on-television interview. The Russians took this once in a lifetime opportunity of an AWOL Dr. Manhattan to ready their missiles to fire at the United States. Of course, that is not what happened. But we will get back to that later. You may be wondering, â€Å"Okay what’s your point? Why are you mentioning all of Dr. Manhattan’s capabilities and how he serves the United Sates? † Well to answer your question, let me restate what I pointed out earlier: In the world of watchmen, Dr. Manhattan makes human achievements and ultimately being human, almost completely irrelevant. Imagine, the nuclear warhead is possibly the most powerful weapon humankind has to offer and Dr. Manhattan can make them disappear with a wink of an eye. Man’s mission to the moon took billions of dollars, a rocket ship, and years of planning and preparation for this life-changing project to become a reality. However, as seen in the opening credits of the film version, Neil Armstrong was not the first person to arrive on the moon. When Armstrong first set foot onto the moon’s surface, what does he find? He finds nothing other than Dr. Manhattan in his, blue, naked form with no spacesuit, no spacecraft, and no artificial aid whatsoever. What does this tell us? Whatever humans can do, Dr.  Manhattan can do it much better. And if humans are ever to make a new life-changing discovery, Dr. Manhattan has already discovered it. However, Dr. Manhattan does have some personal, noteworthy, and very human limitations. In his eyes, he would even call them â€Å"Flaws†. Let’s take a closer look at some of these flaws. For one thing, Dr. Manhattan may be all-powerful and superior to humans but he still experiences human emotions. Namely, love. To expound on the significance of Dr. Manhattan’s ability to love, let me first talk about another flaw of his. Dr. Manhattan is the most powerful being in the Watchmen Universe and he knows it. Soon, his Godlike power eventually causes him to lose all respect for humanity and he begins to question their significance in his life. Getting drunk with power and losing respect for anyone under your power is indeed a very human imperfection. Now, going back to his ability to love, the only reason Dr. Manhattan has not given up on humans and abandon Earth completely was because of one person, Laurie, better known as The Silk Spectre. Dr. Manhattan was in love with her. He even tells her that she had become his only link to humans and without her, he would have no longer cared and simply let the United States and Russia destroy each other. It can even be inferred that if it wasn’t for Dr. Manhattan’s ability to love, Veidt would not have gotten his way and the Russians and Americans would have still caused nuclear war. In the Watchmen storyline, Adrian Veidt, also known as Ozymandias, was meant to appear as the villain. Readers and the audience would be quick to assume that since he was not on the side of Dr.  Manhattan, NiteOwl, Rorschach, and Silk Spectre, and the fact that he killed The Comedian, he was automatically the villain. However, in the end, and to everyone’s surprise, Ozymandias ironically turned out to be the unconventional hero. Veidt’s subtitle of â€Å"World’s Smartest Man† suited him because he knew that the solution to preventing the nuclear war was to direct both superpowers against a common enemy. And that enemy had to be none other than Dr. Manhattan. Somehow, Veidt just knew that the only way to prevent global destruction via nuclear war was to make the United States fear Dr.  Manhattan just as much as The Soviets feared him. Veidt tricked Dr. Manhattan into helping him make generators that could replicate the energy that gave Dr. Manhattan his power. When Dr. Manhattan left the planet and exiled on Mars, Veidt seized the opportunity to attack a number of major cities in the world using energy from the generators he and Dr. Manhattan made. Because of these attacks, thousands of people were killed and the areas affected by the blasts endured colossal damage. Yes, Veidt had killed thousands of people but he believed that sacrifices had to be made if we truly wanted to save the world. After the attacks from Ozymandias, scientists examined the affected areas and the energy readings led the humans to conclude that Dr. Manhattan himself had caused these global crimes. Thus, causing the Americans and Soviets to turn their weapons away from each other and point them towards an even greater threat: Dr. Manhattan. Dr. Manhattan knew that Veidt was right and he also knew that if he stayed on Earth, it would cause even more destruction and more unnecessary deaths. Without hesitation, he left the planet once again.

The Civilized and Self-Cultured Black Man Essay -- Narrative Life Fred

The Civilized and Self-Cultured Black Man In Narrative of the Life of Frederick Douglass, An American Slave, Written by Himself, Frederick Douglass faces the problem of detailing his transformation from slave to man in a manner which is acceptable to both his audience and his own authorial purpose. Douglass must walk the thin line between being powerful and being threatening to his white audience. He attempts to avoid becoming a threat by appropriating the image of a self-made man, as defined in William E. Channing's essay entitled "Self-Culture." Douglass constructs his manhood in terms of civilization, a tactic later employed by Ida B. Wells in her anti-lynching campaign. Although physical strength and the escape from civilization into the wilderness was an equally popular construction of manhood at the time, Douglass follows Channing's belief that true manhood is achieved through knowledge, the mastery of letters and cultivation of manners. This conception of masculinity centers around moral uprightness and self-control a s a means of suppressing passions and desires, the latter being something that most of Douglass' masters lacked. If civilization indicates manhood, then the brutal masters described in Narrative are not men at all. This reversal makes Douglass, the slave turned self-cultured man, a representation of true manhood. According to Channing, every man has the potential to be a great man. Through self-culture, and the resulting moral and intellectual growth, men can expand and live up their potentials, becoming ideal men. Channing understands moral sense as the suppression of passions and desires that are inherent in human nature, but are not good for soul. When a man looks into himself, he discovers...d... ... image of this civilized man is reinforced by Douglass' narrative voice which takes on the Harvard style tone, that sounds much like Channing's voice in "Self-Culture." This tactic may have been to support his use of Channing's ideas, but it also gave Douglass the unique position of speaking in the same style as his audience. This would perhaps be unexpected by his white Northern audience, but nevertheless reinforces Douglass' civility. By taking popular conceptions of civilization, self-control and literacy, and applying them to himself, Douglass invents in himself the representation of true manhood. Works Cited: Channing, William E. The Works of William E. Channing. Boston: American Unitarian Association, 1875. Douglass, Frederick. Narrative of the Life of Frederick Douglass, An American Slave, Written By Himself. New York: Penguin Books USA Inc., 1968.

Explore How Gender Is Represented in ‘Bliss’ Essay

Bliss is targeted at teenage girls. The front cover of the magazine expresses this gender stereotype. An important stage in life is being a teenager. At this point in life, you start forming your own identity and it is hard to do when teenagers are immediately stereotyped and labelled. In particular, teenage girls are portrayed as either sweet and innocent or aggressive and acting too mature for their age. Teenage girls are perceived as being heavily involved in sex from a young age. The film ‘Cruel Intentions’ enforces this idea and encourages teenage girls to grow up fast and act beyond their age – the magazine ‘Bliss’ also encourages this. All teenagers suffer from these harsh stereotypes and compared to ‘Cruel Intentions’ the film ‘My Summer of Love’ shows teenagers trying to break away from these labels. From all the negativity that is being expressed by the older members of society towards the younger, teenagers look to magazines such as ‘Bliss’ for inspiration on how they should look and act. Firstly the title of the magazine ‘Bliss’ appears at the top of the magazine in a big, bold font and in the colour red to make it more vibrant as it is the first thing you pick up on. Its font is Sans serif which is straightforward and informal so the reader will relate to it more. Also, the actual word ‘Bliss’ means a state of perfect happiness so this is implying that the reader will be happy if they read this magazine. ‘Bliss’ is also a name you expect as it reminds the reader of something glamorous or girly which attracts the female stereotype of the girly teenager. In the centre of the cover is a photograph of Taylor Swift who is considered a popular role model among teenage girls. She wears red lipstick which fits in with the colour scheme of the cover (red). The dress she is wearing is in metallic silver and this is in contrast to the red and blue colours to make her stand out more. All the text is framed around the centre image to make the focus on her. She is also using direct address by looking into the camera; this is a form of interaction as the audience may feel connected with the image on the front cover. Also, wrapped behind the centre image is a ribbon with ‘Taylor talks love’ written on it. This is to enforce the idea encouraging teenage girls to learn about love but in this instance, from Taylor Swift. The ‘o’ in the word ‘love’ is represented by a love heart (there are also love hearts surrounding this text). This appeals more too teenage girls as it is implying this magazine issue is all about love and stereotypical teenage girls idealize about love. The ribbon is shaped in order to draw attention to the eye. Underneath the ribbon it mentions a quote from Taylor Swift saying ‘With boys, you have to learn the hard way†¦Ã¢â‚¬â„¢ this is suggesting that girls haven’t learnt about relationships and boys yet, and is encouraging girls to grow up fast and act more mature. Also, the price of the magazine is cheap ( £2.99) compared to other monthly magazines and teenagers are most likely to have low disposable incomes so there is more chance they will buy it. Also, ‘Bliss’ is a monthly magazine so readers won’t have to buy it so many times, so they will save money, again this is more likely for teenagers to buy it. As the magazine is monthly, it will be more detailed and last longer than a weekly magazine so this is more reason for teenagers to read it. The language used on the cover is stereotypically used by teenagers (teenage girls in particular), for example, ‘(So. Much. Goss!)’ this will appeal more to teenage girls as they understand these sayings the magazine uses. Also, this quote is referring to Harry Styles who is part of the boy band One Direction who have a female fan base so to see some text on the cover stating they have loads of gossip about Harry Styles, is going to draw in their fan base which is primarily, teenage girls. In the bottom left corner of the cover is a list of celebrities that are popular among teenage girls. This encourages the male celebrities featured to be possible love interests and encourages the female celebrities to be possible role models. On the front cover, near the top, it states ‘horrifying real-life’ and then follows with a quote from a real life story. The fact they have chosen to feature a real life story applies to the uses and gratifications theory as teenagers can relate to it and identify with themselves. Also, along with the title at the top of page is the website address for the magazine. This shows that the magazine is technology adept and it also creates convergence on an online community. The modern day teenager spends more time on the internet now so it is likely that if they are interested in the magazine they will visit the website as well. At the bottom of the magazine are images of clothes. These images represent teenage fashion and create a desire for the products. ‘Bliss’ makes fashion an important issue and it supports this stereotypical idea that girls are obsessed with fashion and are trying to be mature which has been encouraged by the media. The front cover of any magazine is extremely important because when you are looking for which magazine you are going to buy it is the front cover that is what is going to attract you to each individual magazine. The stereotypical idea of the female gender is seen throughout the front cover of ‘Bliss’ by including features of fashion, gossip, boys and potential female role models. Also the colour scheme of red romanticises the magazine which encourages girls to grow up fast. There is a combination of presentational features used and attention to relevant content ensures the magazine will be extremely attractive to the female gender.

Education †Teacher Essay

The â€Å"education† has been derived from Latin words â€Å"Educare†. â€Å"Educare† means to train, to bring and lead out’, so we can say that education is to bring up, to developing and shaping up the individual talent and his inner potentialities. Definition: Education is a process in which and by which the knowledge, characters and behavior of the human being are shaped and molded. Education is lead to the enlightenment of mankind. According Imam Gzali Imam Ghazali said that education is a process which enables an individual to distinguish between the true and false, the good and bad, the right conduct and the evil doing. Educational policy: Education policy refers to the collection of laws and rules that govern the operation of education systems. Education occurs in many forms for many purposes through many institutions. For example early childhood education, two and four year colleges or universities, graduate and professional education, adult education and job training. Therefore, education policy can directly affect the education people engage in at all ages. Policy 1979 Page 1 National Education Policy 1979 By Roll No. 01,48,12,37,41 National Education Policy, 1979. On 29 March 1972 Zulfiqar Ali Bhutto announced the education policy. As a result all private education institutes were taken into national grip and brought changes in all other aspect of education. July 1977 General Zai-ul-Haq announced that new administration wanted to impose Islamic system. They considered it their aim. They believed that goals could not be achieved unless educational system based on Islamic system. For this purpose General Zia-ul-Haq conducted the conference of teachers, educationalist and of intelligent people. This conference gave recommendation for whole educational system. Muhammad Ali Khan announced this national policy. The main purpose of this policy was to impose education on Islamic system and to impose Urdu language by means of education. Main aim of the National Educational Conference 1979 was: ? Fostering loyalty to Islam. ? Creation of concept of Muslim Ummah. ? Promotion of science and technical education. Recommendation The main recommendation of the education policy of 1979 was following. 1. Elementary Education ? ? ? ? ? In coming five years 13000 schools will have opened Schools will have opened for those girls that were deprived from formal education Enable the students to stand on their courage Residential irony and training centers will have constructed for rural female teacher 5000 masjid will have constructed and books will have provided free of cost 2. Secondary Education ? 2000 new secondary institutes will have opened and converted 1000 middle schools into secondary institutes ? In the curriculum of secondary education new subject will have added ? Scope of secondary education will have intended so that students found take part in productive activities ? Secondary education will have considered from nine class to second year Policy 1979 Page 2 National Education Policy 1979 By Roll No. 01,48,12,37,41 3. Higher Education ? In selected girls colleges of all provinces post graduates classes will have started ? Valuation will have given to teachers of University to extend their education & professional training ? Scholarship will have given to intelligent students and teachers ? In coming five years no other new universities except women universities. New buildings of colleges will have constructed for girls and boys ? Provincial government will responsible to bear all expenses of universities Features: It was said in nation policy 1979 that education is a continuous process. Any educational policy cannot complete without education. Main features of recommendation are given below. 1. Masjid School It was planned in national educational policy that masjid schools masjid will have opened in these schools other subjects will have together alongside primary education. Moreover it was decided to open 5000 masjid school 2. Women Education It was recommended in policy to establish separate women university. Main point was to get attention of women towards education 3. Special Education It is also recommend in policy that central government will have prepared plans for the education of blinds, handicap able. Such person will have prepared to ea rn their livelihood 4. Establishment of private Institution In national policy establishment of private institute were allowed in this way education of inhabitants of country will have increased. Policy 1979 Page 3 National Education Policy 1979 By Roll No. 01,48,12,37,41 5. Mohallah Schools It was recommended to open Mohallah schools for those girls that could not get admissions in formal educational institutes. For this purpose 5000 school were opened 6. Religious Education Arabic will have compulsory up to 8th class. It will have taught as a compulsory subject 7. Village workshop schools It was recommended in policy to open workshops schools for those children who leave study. Main purpose was to enable them to earn their livelihood. 8. Medium of instruction It was planned in policy that all English medium school that get government aids will consider Urdu language as a medium of instruction IMPACT: 1. Clear foundation of education In national educational policy Islamic Ideology of life was considered as base of education 2. University Grants Commission It was decided in policy to give university grant commission to university to save their problems moreover it was said that government would bear expenses of university and these amount were given a grant commission 3. Urdu Language. It also decided in educational policy that all official work will have performed in Urdu language. It was compulsory for English medium schools that get government aids to adopt language selected bay provincial government Policy 1979 Page 4 National Education Policy 1979 By Roll No. 01,48,12,37,41 4. Islamic Madras’s According to the decision of national policy those people were held for public services that have certificate from Islamic Madras’s. in this way benefits of Madras increased and preached Islam 5. Teacher welfare Residential colony was constructed for rural teachers. For getting external & in internal education scholarship was given to teachers Milestones achieved by Education Policy 1979: 1. The medium of instruction was switched over to Urdu in government schools. 2. Private schools were allowed to have English as the medium of instruction. This led to the operation of two different systems of education within the country, one for those who could afford private education, and one for the rest of the nation. This two tier system contributed to a widening socio-economic inequity with the consequent feeling of injustice and resentment. 3. The policy of nationalization was reversed. 4. The private sector was encouraged to open schools. 5. The funding of universities was made through the Federal government. Suggested strategies to achieve goals of Policy: 1. Merging madras and traditional education. 2. Urdu as a medium of education. 3. Effective participation of community in literacy programs. 4. Linked scientific and technical education. 5. Separate instates for male and female. 6. Mosque schools. Implementation: This policy was not implemented properly and failed due to lack of planning and financial resources. Policy 1979.

How to Write a Good Essay

How to Write a Good Essay This thing that we are about to mention has certainly caused great trouble to all of you at least once in your lifetime. Irrespectively of our current occupation (which does not have to be anything connected to any sort of academic writing) every single one of us has had at least one essay assignment during their lifetime. When we think of all those writing assignments we had at school, we come to the conclusion that each and every one of us has had to write a number of essays during our lifetimes. Now, we all claim to be able to write it, however, not all of us can claim that they can write a good essay. Many times you could not help but wonder why your essay was evaluated so low even though you know you have given the greatest effort in its creation. Writing a good essay is far from easy and here we provide a main guideline which will help you write the perfect essay. To write the perfect essay, there are three main things you should dedicate a piece of your precious time to: planning your essay, writing the first draft (which by no means should be the last draft) and finally the editing and proofreading part. After all that is done, you will have the final and optimal version of the essay. The planning of the essay is always the hardest part because even when you have enough inspiration, you often have several ideas on mind and you cannot decide which one to write in particular, whether you will provide a whole essay on facts about that topic, because in an essay, there is just one topic provided by the title that requires your research, not more than one. Choose the topic which will be appealing for many readers and choose the title and make it intriguing to the readers. The second step consists of two things: first, write down on a bulleted list all ideas you want to incorporate in your essay (a phrase for each idea, nothing more) and using that list write your first draft elaborating on those ideas. Finally it has come the time for the editing and proofreading part. Here you can do whatever you think may improve the quality of your written work. If you think that the sentence from the second paragraph should be changed by other sentence, now is the time to do that. After you have done this, read the whole thing one more time and hand it to the person giving you the task.

Jane Ayre analysis essays

Jane Ayre analysis essays Charlotte Bronte makes use of nature imagery throughout "Jane Eyre," and comments on both the human relationship with the outdoors and human nature. The following are examples from the novel that exhibit the importance of nature during that time period. Several natural themes run through the novel, one of which is the image of a stormy sea. After Jane saves Rochester's life, she gives us the following metaphor of their relationship: "Till morning dawned I was tossed on a buoyant but unquiet sea . . . I thought sometimes I saw beyond its wild waters a shore . . . now and then a freshening gale, wakened by hope, bore my spirit triumphantly towards the bourne: but . . . a counteracting breeze blew off land, and continually drove me back"(Bront 159). The gale is all the forces that prevent Jane's union with Rochester. Bront implies that Jane's feelings about the sea driving her back remind her of her heart felt emotions of a rocky relationship with Rochester and still being drawn back to him. Another recurrent image is Bront's treatment of Birds. We first witness Jane's fascination when she reads Bewick's History of British Birds as a child. She reads of "death-white realms" and "'the solitary rocks and promontories'" of sea-fowl. One can see how Jane identifies with the bird. For her it is a form of escape, the idea of flying above the toils of every day life. Several times the narrator talks of feeding birds crumbs. Perhaps Bront is telling us that this idea of escape is no more than a fantasy-one cannot escape when one must return for basic sustenance. The link between Jane and birds is strengthened by the way Bront adumbrates poor nutrition at Lowood through a bird who is described as a little hungry robin. Bront brings the buoyant sea theme and the bird theme together in the passage describing the first painting of Jane's that Rochester examines. This painting depicts a turbulent...

How To Drive 10x More Traffic With Brian Dean Of Backlinko

How To Drive 10x More Traffic With Brian Dean Of Backlinko These days, you need to create both a great Website and great content to rank on Google. Today, we’re talking to Brian Dean, an SEO expert and founder of Backlinko, about how to fuel your 10x content using his research method called the Skyscraper Technique. Black Hat SEO: Stuffing keywords and creating fake signals to rank in Google Google penalized sites using this strategy White Hat SEO: You don’t mind showing Google everything you did to optimize your site Backlinko teaches people White Hat SEO strategies SEO Elements: Keyword and topic research; create content around them Two types of keywords: Information and commercial Create and optimize content that gets the most searches around keywords/topics Differences between well-researched and not researched content and topics Provide one-stop shopping for all the information customers need Skyscraper Technique is a form of research to figure out what content will perform well: Ways to improve content go bigger and better, curate, storytelling, and more Focus on quality over quantity; create less content, make it more valuable Common missteps when implementing â€Å"less is more† strategy and ranking Links: 10X Marketing Formula by Garrett Moon Backlinko Backlinko on YouTube Jon Cooper Tim Ferriss and the 4-Hour Work Week Google Keyword Planner Reddit AMP on iTunes leave a review and send screenshot to podcast@.com If you liked today’s show, please subscribe on iTunes to The Actionable Content Marketing Podcast! The podcast is also available on SoundCloud, Stitcher, and Google Play. Quotes by Brian: â€Å"You really have to create legitimately great content and a legitimately great Website to rank in Google.† â€Å"Everything starts with a keyword with SEO.† â€Å"They just regurgitate what’s already out there and that’s not the type of content that’s going to rank as well on Google.† â€Å"There’s tons of ways to make your content more valuable than the competition.†

ILM Level-2 (Understading Change in the workplace) Assignment

ILM Level-2 (Understading Change in the workplace) - Assignment Example As a manager, I work in the government utility that provides electricity to the consumers. My role in the utility company is dealing with contractors and consultants who interact with the customers in order to get the necessary approvals from the utility and connect electricity to their homes and projects. Since joining the organization, there have been problems with the reporting system by the contractors and consultants leading to delays in electricity delivery to the customers. The utility also lacks a customer feedback portfolio system where they can interact and get feedback for their services from the customers. Therefore, as the manager my aim is implementing change in the utility reporting system by incorporating new technology as well as creating a customer feedback portfolio system to get the consumers feedback. Customer feedback will be essential to determine areas of improvement in an effort to meeting the consumer’s satisfaction. Triggers for change can either be from external or internal factors. External factors arise from the outside environment while internal triggers arise from within the organization itself. According to Fenwick (2001), external triggers are not open to planned change will internal triggers are opened to planned change. External reasons for utility change are as a result of development of new technology; thus, the utility needs to change to accommodate new technology. As well, the change is in demand for the organization services. It is crucial to the utility to incorporate new technology to enhance the reporting system to improve electricity delivery to its customers. Internal triggers towards the utility change are for the need of the organization to improve production efficiency, a need to improve the systems standards as well as the need to improve on the quality of service delivery. Incorporation of a customer feedback system will be

Annotated Bibliography on Coral Bleeching Research Paper

Annotated Bibliography on Coral Bleeching - Research Paper Example Authors concluded that environmental stressors tend to be the primary triggers leading to bleaching. They also suggested that the role that bacteria play in relation to bleaching tends to be that of opportunistic colonization. Therefore, bacteria are not the primary cause of coral bleaching. Anthony, K. N., Hoogenboom, M. O., Maynard, J. A., Grottoli, A. G., & Middlebrook, R. (2009). Energetics Approach to Predicting Mortality Risk from Environmental Stress: A Case Study of Coral Bleaching. Functional Ecology, 23(3), 539-550. There is a high probability of an increase in frequency and severity of coral bleaching events because of climatic changes. According to the article, this is a significant threat to most of the corals ecosystem in various parts of the world. The authors demonstrate a survey they conducted on two Indo-pacific coral species in order to show the coral mortality risks and recovery when bleaching events occurs. Moreover, the authors demonstrate the possibility of curbing coral bleaching through establishing the bleaching rate and duration. Authors conclude that predicting coral mortality rate is a significant achievement to the allocation and management of resources when trying to increase recovery time during bleaching events. Bourne, D., Iida, Y., Uthicke, S., & Smith-Keune, C. (2008). Changes in coral-associated microbial communities during a bleaching event. ISME Journal: Multidisciplinary Journal Of Microbial Ecology, 2(4), 350-363. The article mainly focuses on authors’ study that demonstrates various changes that occur in coral-associated bacteria environments. The article demonstrates that even though increase in sea temperature poses as the main cause of coral bleaching, understanding of various coral-associated communities may help in reducing severe bleaching events. The article also demonstrates a research conducted by the authors that indicates microbial associations

Brooklyn Community Assesment Research Paper Example | Topics and Well Written Essays - 1250 words

Brooklyn Community Assesment - Research Paper Example In order to gather data about the Brooklyn community, various US governmental reports and annual reports of the organizations or the agencies dealing with this particular community have been effectively utilized. Apart from these, valuable data about the community has been gathered through utilizing varied reliable sources including newspapers, websites and community magazines of the US. In order to describe the boundaries of Brooklyn community, it will be vital to mention that a huge proportion of the individuals residing within this community uneducated, which eventually imposed adverse impact on its development. Justifiably, the prevalence of low literacy rate has caused employment related problems in Brooklyn community at large. As per the report published by City of New York (2012), the prevalence of greater unemployment rate has certainly emerged the conduct of numerous violent activities in the locality of Brooklyn community (City of New York, 2012). Apart from this, it can al so be ascertained that medical science and hospital facilities are not up to satisfactory mark, which has been troubling the citizens residing within Brooklyn community. Thus, mortality rate of Brooklyn community is higher than that of the average mortality rate of the US. The report of New York City College of Technology (2013) stated that one out of three adults does not insure their life in Brooklyn community. Similarly, 31 % of the residents within Brooklyn do not get involved in having medical check-up regularly.

Nespresso marketing research Essay Example | Topics and Well Written Essays - 2000 words

Nespresso marketing research - Essay Example This research design consisted of exploratory research done using a local pilot survey by the researcher. A questionnaire design was used due to its in expensive, convenient, and extremely efficient way of collecting a large amount of sample data and varied information from the target audience. In addition, its simplicity and convince in matters pertaining beverages, restaurant dinning behaviors, and consumer interests were taken to be advantageous in this marketing research. The research design included a wide variety of close ended questions intended for the espresso consumer related to the research objectives, and were guaranteed to provide positive required results. The underlying technology of Nespresso originated from Geneva, and Nestlà © the mother company acquired commercial rights in 1974. The idea was to combine the rich market dynamics with technology and experience to come up with a unique product for a specific target market. However, this was marred by a number of tech nical problems that threatened to stall the project such as production and distribution costs which were higher that the turnover. Through highlighting such pitfalls, and identifying potential challenges as the market grows this report hopes to place Nespresso in a better position to grow and gain a competitive advantage. Marketing objective In the process of defining the scope of this marketing research, quite a number of areas were identified as crucial and critical for the growth of the organization. A careful review if the most important areas gave way to the isolation and identification of the following key points as the research objectives. To determine the frequency of using Nespresso products by the target market To determine which service and or products offered by the organization best satisfy market demands

EMPLOYMENT AND DISCRIMINATION LAW 2009-10 Essay

EMPLOYMENT AND DISCRIMINATION LAW 2009-10 - Essay Example The test for less favourable treatment is clearly an objective one and the question that is to be asked is whether the complainant would have been treated differently more favourably had it not been for his sex. Thus, the tribunal must ask what the ‘conscious or subconscious reason for treating the claimant less favourably was’ (Nagarajan v. London Regional Transport)1. The decision of less favourable treatment is for the tribunal to decide and it is not a difficult one. In order to determine less favourable treatment, a comparison with an actual or hypothetical comparator is to be made, however it is necessary that the relevant circumstances of the complainant and the comparative group are same or not materially different. Thus, in Shamoon v Chief Constable of the Royal Ulster Constabulary2, it was stated that From s.63A and Igen v Wong3 it is clear that the evidential burden to show facts from which Employment Tribunal can conclude that the employer has committed an act of discrimination and if such burden is met then the legal burden shifts to the employer who has to show that the reason for the treatment was not related in any way with claimant’s sex. Thus, if an inadequate explanation is provided the Employment Tribunal must fina that the employer committed an act of unlawful discrimination. In the current scenario it is quite evident that Graham has received less favourable treatment on the ground of his sex and this is clear from what has been said by IRU in their reason for rejecting Graham. Furthermore, if a hypothetical comparator is drawn then in the same circumstances a woman would have received more favourable treatment and thus direct discrimination is established. The remedies that might be available to Graham are a recommendation that IRU should take action so as to reduce the effect of the discrimination. Further, he could receive compensation which could include pecuniary losses if any and injury to feelings. For the

Holiday Harassment in Wanda Essay Example | Topics and Well Written Essays - 750 words

Holiday Harassment in Wanda - Essay Example The memories of twenty fifth December are as fresh in my mind as I can remember. The happiness that characterized the morning of that day cannot be compared with another day of the year. Cheers and ululations of women and children from the neighboring villages that sent a deafening voice could be heard from afar. As the first born in the family and one recognized by my mother’s kin, I won the pleasure of being invited to the nearby neighborhood called Wanda where she hails from. Though the place is very remote, it would be a very bizarre idea to reject the offer. So it turned out to be something of an obligation. As a city dweller and one used to travel by vehicle, I could not bear the blunt of walking through the rough terrain to the place. We had to board a taxi at least to display the acme of sophistication. My younger brother and sister were the main accompaniments. No sooner had we exchanged pleasantries with my family than we left for the place. The welcome I received from the people left the onlookers in awe. Greetings alone took half an hour, followed by unending presentation of gifts from their children and grand children. All kith and kin worshipped me, and the ordeal was more graced like a presidential visit. This left an awkward feeling because of the exaggerated welcome. Already, it dawned on me that much was expected from the light pocket I had. I began developing fear. Needless to tell, an eating and drinking program began, and the plates were filled with the normal, fresh, staple countryside food perfect for a celebration of some kind. Without prior confirmation, drinks followed, and I was amazed to be served with the local traditional liquor which I boldly declined. The rejection was treated with a stern look by the uncle. The lack of courtesy and genuineness began making the day boring early as it was. Not aware that this was only smoke and fire coming, people followed by small crowds began flocking the compound casting a glance at me every time they entered the house. I did not give a serious thought to these looks with the perception that it was a day of celebration and togetherness during such a day is the norm. Little did I know that I was the centre of attraction? The uncle and his wife had invited the whole village to come and see their rich nephew who resides in the city and who would bring money during the Christmas Day. Unfortunately, wishes are not horses because if I had known this, I would have turned down the offer immediately it was presented. When all the â€Å"guests† arrived, songs of praise began and I was surrounded as if I was the Christ himself. In fact, what I witnessed during that time left me shivering like a leaf on a windy day. The villagers were drunk and disorderly causing a sheer pandemonium in the house. Every man and woman was demanding that I buy them a packet of sugar a nd flour which is tantamount to fifty dollars each. I was even compelled to take the liquor I earlier

EMPLOYMENT AND DISCRIMINATION LAW 2009-10 Essay

EMPLOYMENT AND DISCRIMINATION LAW 2009-10 - Essay Example The test for less favourable treatment is clearly an objective one and the question that is to be asked is whether the complainant would have been treated differently more favourably had it not been for his sex. Thus, the tribunal must ask what the ‘conscious or subconscious reason for treating the claimant less favourably was’ (Nagarajan v. London Regional Transport)1. The decision of less favourable treatment is for the tribunal to decide and it is not a difficult one. In order to determine less favourable treatment, a comparison with an actual or hypothetical comparator is to be made, however it is necessary that the relevant circumstances of the complainant and the comparative group are same or not materially different. Thus, in Shamoon v Chief Constable of the Royal Ulster Constabulary2, it was stated that From s.63A and Igen v Wong3 it is clear that the evidential burden to show facts from which Employment Tribunal can conclude that the employer has committed an act of discrimination and if such burden is met then the legal burden shifts to the employer who has to show that the reason for the treatment was not related in any way with claimant’s sex. Thus, if an inadequate explanation is provided the Employment Tribunal must fina that the employer committed an act of unlawful discrimination. In the current scenario it is quite evident that Graham has received less favourable treatment on the ground of his sex and this is clear from what has been said by IRU in their reason for rejecting Graham. Furthermore, if a hypothetical comparator is drawn then in the same circumstances a woman would have received more favourable treatment and thus direct discrimination is established. The remedies that might be available to Graham are a recommendation that IRU should take action so as to reduce the effect of the discrimination. Further, he could receive compensation which could include pecuniary losses if any and injury to feelings. For the

Al-Qaeda in Southeast Asia Essay Example | Topics and Well Written Essays - 5000 words

Al-Qaeda in Southeast Asia - Essay Example Consistent with this fact, the term ‘Al Qaeda’ was not Christened by Osama bin Laden; rather, it was the United States intelligence agency CIA that referred to the Islamic activists led by bin Laden in this manner in the mid-1990s. Al Qaeda, translated from Arabic, literally means a â€Å"foundation or precept’. The term Jemaah Islamiyah, a terrorist outfit that has its roots in Southeast Asia is translatable into â€Å"Islamic community† (Shuja, 2006, p.447). Hence, the employment of terrorism is not an intrinsic aspect of these organizations. Terrorism is only a tactic that was adopted during the last decade or so, but there is nothing inevitable about it. This fact should be kept in mind by Australian security agencies, while drawing awareness campaigns and security measures, for far too often western intelligence tends to portray these Islamic groups to indulge in terrorist activities for terror’s sake. This is not true. The Jihadists’ ob jective is to defend their faith and their way of life, which they feel is threatened by the western cultural and military interventions in the Islamic world (and there is sufficient proof to support this assertion). To understand how Al Qaeda gained support in Southeast Asia, it is important to gain cognisance of its founding principle, i.e. Al Qaeda was founded on universal Islamic precepts of jihad and brotherhood. And the present wave of Islamic revivalism and the rise of Islamic fundamentalism in Southeast Asia originated during the 1970s.

Macbeth Film Comparison Essay Example for Free

Macbeth Film Comparison Essay Compare and contrast the opening scenes of Polanskis 1971 film version of Macbeth with Geoffrey Wrights 2007 adaptation. Roman Polanskis and Geoffrey Wrights adaptations of Shakespeares Macbeth are filmed in different styles despite being based on the same play. This may be to suit a different audience or convey a different message to one another. Roman Polanskis 1971 reproduction opens on a wide angle shot of a beach with a sunrise coming up over the horizon. This creates a feeling of morning, and that this is just the start of a storyline. After this, three old, weathered women appear and dig a hole in the sand- allowing a mysterious atmosphere to develop, which leaves the audience wanting to know more. The witches then bury a dagger encased in a severed hand and a hangmans noose. These items allow the audience to ponder upon the connection of the items. The witches then say their goodbyes and wander off along the beach, the only sound being the squeaking of their cart used to haul the ritual items in. This shot is quite simple, but it creates a feeling of anticipation. Geoffrey Wrights 2007 adaptation opens in a more 21st century blockbuster style, with attractive young schoolgirls playing the part of the witches who vandalise a graveyard by gouging out the eyes of statues of angels and spraying the eyes of the statues with red spray paint. This is quite an aggressive scene to start with, and sets the pace for the rest of the film. Compared to Polanskis version, this introduction offers a more up-beat feel, instead of the more sombre style of the 1971 film. The camera then pans round to a close-up of Macbeths face whose attention is drawn to the young schoolgirls as they wander past him. He then looks at his wife who is kneeling over their dead sons grave crying. Again, another close-up, but this time of Lady Macbeths face which at this point is not particularly attractive. This could show Macbeths desire for a prettier woman in the schoolgirls, and reality- the less attractive sight of his wife; but in the end, no-one knows what he is thinking, just that he is not comforting his wife. Here, the atmosphere is quite tense- lots of things are happening at one time which makes you feel like you are there, in Macbeths hectic, confused mind. In relation to Polanskis film, this film is less mysterious and makes you expect fewer twists because there have been not many so far. The title graphics in Polanskis film are set in a Roman style font, Seriffed and coloured black. The aged font emphasizes the fact that the film is very traditional. This style of writing is often used in newspaper articles. The 2007 adaptation uses a much more modern, contemporary sans-serif font. The text is coloured red- a recurring theme in this film. In the 1971 version, a wide angle shot of the beach is the start of the film. This wide angle shot is used throughout the first scene to depict the bleak landscape that the film is set in. The wide shot could also be showing us the bigger picture- that there are many little thing that make up the plot of Macbeth, and this is just one little thing on a wide, open beach. Geoffrey Wrights film does not include many wide- angle shots in the first few scenes. This is most probably because of the action-packed nature of the film. Therefore the camera follows the action intensely- for example following the witches around the graveyard. This gives the audience an adrenalin rush- especially in the action scenes where the audience can perceive themselves to be taking part in the violence. In both films however, close-up shots of the faces of the main characters are shown. In Polanskis film this is to show mainly emotion- the creepy expressions of the witches, and Macbeths blank expression when shown in a close-up. When Macbeth is first shown, invaders are being hung in the background- but Macbeth retains his blank facial expression- suggesting that he has no feelings for those being hung. Geoffrey Wrights film shows close-ups of the faces of the witches defacing the statues at the graveyards. These shots show the determination that the witches show by their facial expressions to destroy all that has to do with God and heaven in the graveyard. The close-ups of Lady Macbeths face show her weakness in her love for her dead child. Polanskis film uses very weak morning light as a setting for the beach scene. This gives a dull, grey, washed out look to the beach. The beach seems quite uncomfortable, as it is daybreak and there is almost no light and the open beach makes you feel cold inside creating an atmosphere that hints to you that something bad is about to happen. Similarly, the 2007 version seems to be shot in the day, but there is very little light as the graveyard is overcast. Despite this, the graveyard feels more comfortable due to the auburn hair of the witches which seem to emit warmth and light- allowing the audience to feel more relaxed and enjoy the action scene that follows. Polanskis film opens with the witches burying strange items that all link to death and suffering- a dagger, a noose and a severed hand. Blood (possibly a symbol of murder) is then poured over the items. The witches then spit on either side of themselves, possibly to bind themselves to the witchcraft they are taking part in. the weather at that time is bleak ,and a thunderstorm is brewing- possibly suggesting a little cheaply hat something bad is about to happen. At that point, after the title sequence, the king gallops onto the beach to the sound of trumpets- symbolic of royalty and fame. In Geoffrey Wrights adaptation, a recurring theme of red is used from the start of the film. This colour represents blood, murder, death, danger, and the underworld. For example, the witches hair is Auburn, suggesting that they pose a mild danger to Macbeth. Also, The Cawdor- the bar which is used as a drugs den, has red wallpaper- suggesting that it is part of the underworld. The witches vandalise a graveyard at the start of the film, showing their hatred towards God and heaven. They gouge out the eyes of the angels- possibly making them blind to what is about to happen. Red spray paint is forcefully sprayed in the eyes of the statues, also making them oblivious to the witchcraft about to take place. Crosses are also defaced- possibly a reference to Macbeths worries about his afterlife. After the vandalism, the girls quieten down, possibly showing an ounce of respect seen as though the place they just demolished is a graveyard. Macbeth is dressed in casual attire, but in black, as in the introduction, he is supposed to be mourning his sons death. Macbeths wife also lays down white roses- symbols of love and innocence- ironic as in the end, nobody seems to be innocent! Later on, as Macbeth and his gang chase a drug dealer from the underworld (with the prevailing colour of red), yellow street lights and buildings are shown- this separated the real world from the underworld. This shows the audience that Macbeths actions are not within the realms of what a normal person would do, and that in order to carry on with his normal life; he must keep his actions inside the underworld. Music is an important part in setting the scene for a film, and in Roman Polanskis film, a droning, repetitive, chaos-inducing tune is used which shows the kookiness of the witches. When Macbeth is shown, a drum beat, not dissimilar to that of an army march beat is used. This shows how Macbeth is a soldier and will fight for his king. The King has music played on a trumpet- vey regal and flattering, this shows his position clearly as a monarch. The music played for the different characters is mostly to show who they are in terms of status; and the music is used instead of a lengthy introduction, allowing the audience to apply stereotypes to the different characters via the music and paint a picture in their minds about the character, but on a deeper level than shown on screen. While the title graphics are showing, fighting sounds are played- simulating the sounds of a battlefield. Plus with swords clanging and maces clashing, the audience are allowed to recreate their own battle in their minds without the help of visual hints. The 2007 version uses similarly annoying, grating noises for the witches- but this time using hissing sounds- possibly a link to the devil posing as a snake in the Bible story of Adam and Eve, where the snake fools Eve into eating the Apple, who then fools Adam into also eating the apple- an uncanny resemblance to the tragedy of Macbeth. Instead of showing a blank screen while showing the title credits, Wright preferred to show a gung-ho showdown between Macbeths gang and an Asian gang. Here, the music is loud and upbeat in contrast to the hissing beforehand- just like the 1971 version. Possibly in an attempt to entice the audience of the 21st century, Wright uses very violent scenes- such as depicting men being shot with submachine guns by Macbeth. Again- this may have been done to excite the audience; and instead of letting the audience make up the fight in their minds, a graphical representation has been put on a plate for them. This was not done in 1971 due to the social taboos against showing excessively violent scenes in films- a theme that runs right through the 2007 version as nowadays, these types of scenes are generally being seen as more and more acceptable; despite many believing that suggesting is much more powerful than stating- as could be the case in Wrights version. Roman Polanskis film shows witches dressed in ragged clothes, unwashed and with no shoes. This allows the audience to see immediately that these women are strange, and not very wealthy. The king on the other hand is shown to wear a fine suit of armour, with a polished helmet- showing his social importance and wealth. Macbeth lies in the middle of the two extremes- not exuberantly poor like the witches- as he wears chainmail and shoes; but not very wealthy and important- as he has no banner or shiny helmet. This simplistic method of categorising people shows the simplistic way in which Polanski is trying to depict the characters and show the audience how Macbeth is lodged between the two extremes of wealth and social status. When Macbeth meets up with his gang for the action sequence, all of his gang are dressed casually in dark clothes. All except the gangs Consigliere (the Kings son) who is dressed in a smart black suit with a red tie- again, with reference to the recurring theme of red, this time showing him as royalty, and as having a higher social status than the other gang members. Hair is an important part of first impressions- in Polanskis film, Macbeths hair is not shown in the introduction, and is hidden by a chainmail hood. This could hint at Macbeth being sheltered from evil and guarded due to his hood acting as a safety blanket. The King wears a crown- a symbol of true royalty, and his hair is uncovered- possibly showing that he is weak. Geoffrey Wrights adaptation also depicts the King as being weaker than the other characters when his hair colour is looked at. The King is shown as having very fair, blonde hair- again being a symbol of innocence and weakness. The witches in Polanskis film have different hairstyles- two have hoods- like Macbeths but made of cloth, and one has dirty, unwashed brown hair. This array of hairstyles allows the audience to realise that the witches are individuals, and are not all identical in the way they behave. On the other hand, the 2007 version shows all of the witches having the same hairstyle and colour- that being red- with connotations to blood and death. This also is trying to show the audience that they are quite aggressive and possibly have links to the devil. Roman Polanskis film depicts Macbeth with 1970s style censoring- no explicitly violent or sexual scenes; but traditional hints at what is happening. Wrights version is essentially a film from a totally different time period- showing excessive violence to help the modern audience understand what is going on. I think that despite the sometimes cheesy details of the film, Polanski has created a classic that really entices the audience and makes them wonder what is going on when subtle hints are dropped directing the viewer on the right direction in terms of their mental picture of the scene. The 2007 version shows how complacent modern-day audiences have become with violence and nudity in films. I think that this is mostly down to the filmmakers wanting to make the film more exciting- in some ways they have, as the action scenes in the film can be quite gripping. But as a teenager, I think that more needs to be done in order to let my imagination get to work and try to think of what is really happening, and what is the film trying to tell me beyond the gratuitous violence.

Immune System of a Plant

Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà ­a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164  µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10  µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65 °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20  µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65 °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37 °C and resuspended in sterile deionized water for a final volume of 500  µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20  µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200  µM dNTPs, 0.2  µM forward primer, 0.2  µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1  µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ã…Â az ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin

Just Say No! A Profile Of Cocaine And Its Effects On Two Lives Essay

Just Say No! A Profile Of Cocaine and It's Effects On Two Lives   Ã‚  Ã‚  Ã‚  Ã‚  Greek mythology tells of a young god, Morpheus, god of dreams. Morpheus planted a special purple flower called the lotus. Soon the people of the land smelled the sweet flowers and ate them. They immediately feel into a deep and troubled sleep. From that day on, they awoke only long enough to gather the lotus flowers and sleep again. Eventually they lost their strength and willpower and wanted only to drift in and out of sleep.1 The story of the lotus-eaters and similar tales from ancient times show us that drug use is not new. Today this problem threatens all of our society. The worst, most deadly of drugs, however, is cocaine. This report will talk about what cocaine is, what it does to the human body, and two fantastic people who gave their lives because of it.   Ã‚  Ã‚  Ã‚  Ã‚  Today, over 5 million people use cocaine each month. Each day, 3,000 people try cocaine for the first time.2 Cocaine is a white powder made from the leaves of the cocoa plant. Cocaine is first pressed to form a paste; then, the paste is mixed with strong chemicals to make a white, powdery mixture. Most cocaine comes from South America. It is estimated that about 400 tons of cocaine is smuggled out of South America each year. Half of this cocaine ends up on the streets of the United States.   Ã‚  Ã‚  Ã‚  Ã‚  Cocaine is a stimulant. That means that when it is us...

Speech Aboutlove

Speech about Love Love is known to be one of the most important human values. Everyone wants to love and to be loved! Virtually everyone is capable of this wonderful feeling. Love is of multifaceted nature. Sometimes because of it we may think that our  beloved people  have qualities they really do not have. At the same time, this  feeling  helps reveal all the positive features of  the person we love. Only true love is able to change people for the better. It makes us forgive and find happiness in the  happiness of a beloved man or a woman.Therefore,  love  is the most complex and the most deep human feeling. Sometimes love makes people do heroic things. Love can make life full of joy, fun and laughter. This feeling is able to give us a brand new life, help us gain new strengths and creative forces†¦ At the same time,  love is a very complex feeling  since it is associated not only with  tenderness and joy, but also with pain and tears. Everything is not a s simple as it may seem. That is why many writers compare love with  falling into the abyss. We are all different and we all express our love in different ways.The very notion of â€Å"love† has a completely different meaning to different people. But we all love and want  to be loved, and we are all united by this desire. This is the†¦greatest miracle. Those who don’t know what  love is†¦ Speech on Dreams Have you ever wondered how dreams come about†¦ whether the BFG really existed? That this huge giant would stalk around at night catching dreams to trap them into jars and blowing them into your ears to determine what sort of dreams you would have that night? Well, you will find out very soon. Good morning to one and all.Today, I will be delivering a speech on the topic ‘dreams'. I'm sure many of u here might find this topic strange. A speech? On dreams? You must be joking! Some of u might scoff. But perhaps, after listening, you might realiz e it is actually quite interesting. Did you know it is possible that you can get rid of your fear of something in your dreams, and that's because the things we are afraid of during the daytime often turn up again in our nightmares. We can make good use of this, however. It appears that some people deal with their daytime fears in their dreams.This was the case in the following example: A woman was awfully afraid of spiders. In a dream a big spider was approaching her. The hairy crawler came nearer and nearer, until it touched her. But she felt quiet, and not afraid. Afterwards she noticed that by day she was no longer afraid of spiders either. Sounds amazing? Well, this is not at all as mysterious as it sounds. ‘Overcoming your fear' in this way is also possible in your dream. Nightmares can be caused by some physical problem (a well known example is someone who dreams about fire and wakes up with a fever).Speech Friendship Friendship is when they push when you need it, but ne ver too hard and stand back when the time is right but never too far and the true test of friendship is if you’re willing to do it all back in a heartbeat. It’s when your life is so much better because your know them and they bring out the best that lies within. Good morning fellow classmates and Mr. Hampton. Today I will be talking to you about friendship and the important role that it plays in our lives. People today, in all this new world technology and thinking have lost sight of what a true friendship is.No way do friends have to be exactly the same, I mean come on friends do have similarities but they also have their differences. The key to opening up the world of friendship is not just to focus on the similarities but to accept each others faults because true friends do not judge each other. Friends love unconditionally. They do have their little angry moments from time to time but at the end of the day all is forgiven and forgotten. Why let something that happe ned in the past ruin what great friendship you could have together in the

World Reaction to European Expansion between 1700 and 1900

In the 18th century, there was an increased urge in Europe to venture abroad, to discover, explore lands that as yet remained unknown. Part of the need to go beyond the boundaries of Europe was rooted in the industrial revolution that had begun to take place at the time. Machines such as the steam engine were being built and this greatly facilitated transportation. There was also improved ocean going vessels which facilitated for the European explorers venturing further away from home.The creation of cotton mills meant that European nations had to look abroad more extensively so as to expand markets. The Industrial revolution and the response of the world In the 18th and 19th centuries, Europe was the world power to reckon with. The industrial revolution started in Great Britain and it was facilitated by several factors. One is that Britain had large deposits of coal and adequate supply of water that was needed to run the machines such as steam engines. Britain also had the plus of d eposits of iron ore that was needed to make this machinery and tools.She had an internal water system that facilitated the transportation of people and goods as well as a good ports and harbors that facilitated international trade. To cap it all up, she had a sound banking system which meant that projects could be financed and an established government that provided the foundation for a thriving business environment (Brown, 1991). There were several and diverse implications for industrialization and the European expansion, which, predates even the industrial revolution (Ringrose, 1998).The revolution was just a means to hasten European occupation of distant lands abroad. Even in the earlier centuries, Britain had made frays into Asia as she sought trade routes that would enable her to access the abundant riches of China’s silk. The Spaniards were at the same time trying to find their way into Latin America where they expediently eliminated the native Indians and replaced them with African slaves. This was Europe’s story, replicated by the French, Dutch and Portuguese in different parts of the world. For Africa, India and Australia, the European expansion meant colonization.While in earlier times European nations had had only a singular interest in Africa, that of being a ready source of slaves who were at the time considered a price commodity, industrialization brought a change because Africa was now seen as a source for raw materials needed in European factories as well as a ready market for the finished products. The Berlin conference of 1814 saw to the scramble and partition of Africa among European colonial powers with the largest shares going to the strongest, then Great Britain (Aldcroft & Rodger, 1984).Not only was Europe seen as the world’s centre for trade and commerce, but it was also perceived to be the intellectual headquarters of the civilized world. From the mid 18th century when the age of enlightenment had truly began to ta ke hold, there were physical as well as intellectual and moral revolutions going on concurrently. Philosophers and other great thinkers in all fields called for the denunciation of tenets that preciously had been taken for granted and without question, as they said that reason has to reign supreme.Institutions that had once upon a time been regarded as being beyond reproach such as the church and the nobility were all subjected to intense scrutiny that at times found them wanting. Here is where the seeds of activism first germinated. From this would later arise the spirits of capitalism, feminism, civil rights movements and calls to nationalism in which the whole world would follow suite (Brown, 1991). However there were negative ramifications from the European invasion that was so all-encompassing.The most obvious is that there was the creation of a class where the Europeans were cast in the light of being superior to the natives. The natives themselves had to be subdued and shown their rightful place. This often resulted in the native’s loss of freedom and inhumane treatments against him. The natives were often cast out of their own lands if the Europeans were interested in the natural resources that abounded there. The natives were then pushed into restricted marginalized areas where their movements could be monitored. They became prisoners within their own homelands (Ringrose, 1998).Another negative impact was the abolishment of existing political and legal systems that had been established by the natives to be replaced by the Europeans own which they felt was superior and hence much better. There was the intent destruction of cultural practices that had been in place for centuries because the Europeans had found them to be barbaric or uncivilized (Eltis, 1987). European expansion resulted in the colonization of several countries of the world that lasted for over a century or more, in some regions of the world (Aldcroft & Rodger, 1984).Of course the industrial revolution brought about better standards of living for all, but the way in which European nations tried to assert their influence by taking forceful control of the geographical regions of the world from which they felt they would most benefits with impunity, was more barbaric than the hedonistic tribal practices that they condemned so strongly. It is only because the European nations were much stronger than those they sought to conquer that they were able to get away with the actions that they carried out in the 19th century periods.However, just because they got away with it does not mean they do not deserve to be chastised for planting the seeds of economic and racial inequality whose ghosts still haunt our world to date. Conclusion There was an unprecedented rate of change that took place in the two hundred year span between the 18th and 20th centuries that had never before been seen in history. This change took on all the aspects of people’s lifestyles; from how they produced their food, how they got their work done, how they travelled and even how they perceived the world. Though this change had its roots in Europe, its impact was felt throughout the world.From the colonized states of Africa, Asia and Australia, to the great American shores, the influence of European nations was pervasive. Europe as a continent was a fore runner in shaping how the rest of the world would do its commerce, conduct their governments and affairs of state and even to some extent their religious inclinations. The shift in world powers might have placed control in different hands but the impact that Europe had in its heday, is one that is still being felt and seen, and will continue to be felt and seen for many generations yet.Cited works David Eltis, Economic growth and the ending of the transatlantic slave trade Oxford University Press US, 1987 David R. Ringrose, Spain, Europe, and the â€Å"Spanish miracle†, 1700-1900, Cambridge University Press, 19 98 Derek Howard Aldcroft & Richard Rodger, Bibliography of European economic and social history, Manchester University Press ND, 1984 Richard Brown, Society and Economy in Modern Britain 1700-1850 Routledge, New York 1991